Molecular Authentication of
Commercially Cultivated Coffee (Coffea spp.)
in the Philippines using DNA Barcodes
Arleen C.
Panaligan1,2*, Miriam D. Baltazar2,3 and Grecebio Jonathan D. Alejandro1,4
1The Graduate School, University of Santo Tomas, España, 1015 Manila, Philippines
2Department of Biological Sciences, Cavite State
University, Indang, 4122
Cavite, Philippines
3National Coffee Research,
Development and Extension Center, Cavite State University, Indang, 4122 Cavite, Philippines
4College
of Science and Research
Centre for the Natural and Applied Sciences, University
of Santo Tomas, España,
1015 Manila,
Philippines
*For
correspondence: acpanaligan@cvsu.edu.ph
Received
08 August 2020; Accepted 19 September 2020; Published 10 December 2020
Abstract
Accurate identification of commercially cultivated coffee species is
necessary since the cup quality may be attributed to the kind of species used. Hence, DNA barcoding was performed using nuclear ribosomal
internal transcribe spacer (ITS)
and maturase K (matK). Both markers had 100% amplification and sequencing
success rates. Although ITS
had lower resolution in Coffea species,
it efficiently discriminated Coffea liberica. The matK barcode discriminated all the species. Findings revealed that matK is an efficient barcode over ITS for commercially cultivated Coffea
species by generating the highest rate of both universality and discrimination
power. DNA barcoding as a method of authentication will benefit the coffee industry and coffee growers for large-scale plantations. © 2021
Friends Science Publishers
Keywords: Coffea spp.;
DNA barcode; ITS; matK
Introduction
Coffee (Coffea L.) belongs to the Rubiaceae family, comprising of 124 species (Davis et al.
2019). Among these
species, C. arabica L., C. canephora Pierre ex A. Froehner and C. liberica W.
Bull ex Hiern are commercially cultivated in the
Philippines. C. liberica has two known varieties, namely, excelsa and liberica. Generally, the
fruits of var. liberica are bigger, more tapered at the base, have thicker
and leatherier pericarp than that of var. excelsa (Bridson 1988).
Planting
materials such as seedlings need accurate identification since the market value of
coffee depends on the cup quality which may be attributed to the species.
Consumers tend to choose C. arabica (locally
known as Arabica) because of its rich aroma. C. canephora (locally known as Robusta) is more bitter and has
higher caffeine content than C. arabica
(Lecolier et al. 2009), while C. liberica
(locally known as Kapeng Barako) has a strong flavor.
Morphology-based identification is the
usual method of identifying plants including coffee. However, it is difficult
to discriminate Coffea species at the seedling stage. Generally, distinct characteristics of Coffea species can be observed at
maturity but they still possess overlapping characters (Panaligan et
al. 2020). Another
technique that can be used for species identification is the utilization of
short DNA sequences as barcodes. This technique is
not dependent on environment and life stages (Hebert et al. 2003). The matK marker was used in this study because of its
greater plant species
discrimination (CBOL
Plant Working Group 2009). The nuclear
ribosomal internal transcribe
spacer (ITS) was added to matK as suggested by the China Plant BOL
Group (2011). The ITS and matK
were used to assess possible barcodes in authenticating commercially cultivated Coffea species in the Philippines. Hence, this study aims to evaluate the PCR success rate,
sequencing success rate, and discriminatory power of ITS and matK.
Materials and
Methods
Sample collection and amplification
of the DNA barcodes
Young coffee leaf samples were collected and stored in bags with silica gel for DNA extraction. Herbarium vouchers were made and
deposited at the University of Santo Tomas Herbarium (USTH).
DNA samples were extracted following the protocol of
Dneasy Plant Minikit (Qiagen, Hilden, Germany). Using universal primer pairs
(Table 1), the ITS and matK regions were amplified with a total
volume of 25 μL per reaction. The PCR mixture contained 19.45 μL water, 2.5 μL 10x reaction buffer, 0.5 μL 50 mM MgCl2, 0.4 μL
10 mM dNTP, 0.5 μL 10 μM forward and reverse primers, 0.15 μL 5u/ μL Taq DNA polymerase (Vivantis) and 1.0 μL
DNA. The PCR amplification was performed using a T100 Thermal Cycler (Bio-Rad) as follows: initial
denaturation at 97°C for 90 s followed
by 35 cycles of 95°C for 30 s, 55°C for 20 s (ITS) or 50°C for 20 s (matK), 72°C
for 1 min,
followed by final extension at 72°C for 10 min (Li et al.
2012). The PCR products were purified using QIA-quick Purification Kit (Qiagen, Germany) and
sent to Macrogen Inc., Seoul, South Korea for bidirectional DNA sequencing.
Sequence analyses
Consensus sequences were edited and
assembled using Codon Code Aligner v. 4.1.1 (Codon
Code Co., Centerville, MA, USA). Multiple Sequence Alignment was
performed using MEGA 7 (Kumar et al. 2016). Neighbor-Joining (NJ) trees were constructed in MEGA 7 using 1000 bootstrap replicates. Pairwise
distances of these markers were computed using Kimura–2–parameter (K2P) model (Kimura 1980) with MEGA 7
software (Kumar et al. 2016). Wilcoxon two–sample test was performed using
S.P.S.S. software (version 20.0; S.P.S.S. Inc., Chicago, U.S.A.).
Results
A total of 48 sequences were newly generated in this study from ITS and matK and were
deposited in GenBank (Table 2).
Table 1: Universal primers of the two candidate
barcodes
Primer |
Primer sequence
(5’–3’) |
Reference |
|
ITS |
ITS5 |
GGAAGTAAAAGTCGTAACAAGG |
White
et al. (1990) |
|
ITS4 |
TCCTCCGCTTATTGATATGC |
|
matK |
3F_Kim f |
CGTACAGTACTTTTGTGTTTACGAG |
CBOL-
PWG 2009 |
|
1R_Kim r |
ACCCAGTCCATCTGGAAATCTTGGTTC |
ITS = internal transcribe spacer; matK = maturase K
Table 2: List of Coffea species used
in the study and their accessions
Place of Origin/Collection Place |
Code |
USTH Accession |
GenBank Accession |
||
ITS |
matK |
||||
C. arabica |
Indang, Cavite |
A1 |
014856 |
MK611791 |
MK722268 |
C. arabica |
Indang, Cavite |
A3 |
014857 |
MK611792 |
MK722267 |
C. arabica |
Ampasit, Benguet |
A31-1 |
014858 |
MK615726 |
MK722270 |
C. arabica |
Ampasit, Benguet |
A31-2 |
014859 |
MK615727 |
MK722269 |
C. arabica |
BSU, Benguet |
A311-1 |
014860 |
MK615728 |
MK722266 |
C. arabica |
BSU, Benguet |
A311-2 |
014861 |
MK615729 |
MK722265 |
C. arabica |
Mascarenes/Nicaragua – |
– |
DQ153609 |
AB973195 |
|
C. canephora |
Indang, Cavite |
C1 |
014862 |
MK615730 |
MK722259 |
C. canephora |
Indang, Cavite |
C2 |
014863 |
MK615731 |
MK855097 |
C. canephora |
Alfonso, Cavite |
C6 |
014864 |
MK615732 |
MK722261 |
C. canephora |
Alfonso, Cavite |
C7 |
014865 |
MK615733 |
MK722260 |
C. canephora |
Indang, Cavite |
C8 |
014866 |
MK615734 |
MK722264 |
C. canephora |
Indang, Cavite |
C9 |
014867 |
MK615735 |
MK722263 |
C. canephora |
Indang, Cavite |
C10 |
014868 |
MK615736 |
MK722262 |
C. canephora |
NOMIARC, Bukidnon |
C512-2 |
014869 |
MK615737 |
MK722258 |
C. canephora |
NOMIARC, Bukidnon |
C513-2 |
014870 |
MK615738 |
MK855098 |
C. canephora |
Cameroon/Vietnam |
– |
– |
DQ153593 |
AB973198 |
C. canephora |
Mexico/Indonesia |
– |
– |
MF417755 |
AB973197 |
C. liberica |
Indang, Cavite |
L1 |
014871 |
MK615739 |
MK722250 |
C. liberica |
Indang, Cavite |
L3 |
014872 |
MK615740 |
MK722249 |
C. liberica |
Alfonso, Cavite |
L6 |
014873 |
MK615741 |
MK722253 |
C. liberica |
Silang, Cavite |
L7 |
014874 |
MK615742 |
MK722252 |
C. liberica |
Alfonso, Cavite |
L8 |
014875 |
MK615743 |
MK722251 |
C. liberica |
Indang, Cavite |
LE1 |
014876 |
MK615744 |
MK722255 |
C. liberica |
Indang, Cavite |
LE3 |
014877 |
MK615745 |
MK722254 |
C. liberica |
Alfonso, Cavite |
LE7 |
014878 |
MK615746 |
MK722257 |
C. liberica |
Silang, Cavite |
LE8 |
014879 |
MK615747 |
MK722256 |
C. liberica var. dewevrei |
Central African Republic |
– |
– |
DQ153603 |
– |
C. liberica var. liberica |
Congo/ not indicated – |
– |
DQ153610 |
AM412465 |
USTH = University of Santo Tomas Herbarium; ITS =
internal transcribe spacer; matK = maturase K
The ITS
and matK regions were 100% amplified
and sequenced (Table S1). Interspecific
distances of ITS and matK were significantly higher than their intraspecific
distances (P ˂ 0.001) (Table S2). There were two members of C. canephora that interclustered with C. arabica in the Neighbor-Joining tree
of ITS (Fig. 1A), while matK
discriminated all the Coffea species (Fig. 1B).
Fig. 1: Neighbor-Joining tree inferred using
Kimura two-parameter distances and 1000 bootstrap replicates of (A)
ITS and (B)
matK. Numbers on nodes are
bootstrap support (BS) values. Outgroups were obtained from GenBank. Note: A = C.
arabica; C = C. canephora; L = C. liberica (liberica); LE = C.
liberica (excelsa)
Discussion
The high amplification and sequencing success rates of ITS and matK indicate that these DNA barcodes are universal for Coffea species. The universality of ITS and matK are congruent with the findings of Huang
et al. (2019) and Amin et al. (2020). Having significantly higher
interspecific than intraspecific distances
suggests that these two candidate barcodes have the potential to discriminate Coffea at
the species level. The lower discriminatory power of ITS as compared to matK has previously been reported by Chen et al. (2020). In this study, matK had higher discriminatory power than ITS (Fig. 1), which is incongruent with the finding of
Huang et al. (2019). The different results of these studies imply that
the efficiency of a DNA barcode varies in different genera and species. As an
example, ITS was efficient in discriminating C. liberica but was not able to discriminate C. canephora. Some species would be better
resolved by other DNA regions, as
exemplified by matK, which discriminated all the Coffea species
(Fig. 1B).
In the Philippines, there are four known coffee types and these are ‘arabica’, ‘robusta’, ‘liberica’, and
‘excelsa’ corresponding to C. arabica, C.
canephora, C. liberica and C. excelsa, respectively. However,
Panaligan et al. (2020) reported that liberica and excelsa (locally known
as Kapeng Barako) belong to a single species
that is C. liberica. In this study, the NJ trees for
ITS and matK showed that liberica
and excelsa grouped
in a single clade (Fig. 1), thus supporting the result of the previous study that
liberica and excelsa belong
to the same species (Panaligan et al. 2020).
Conclusion
Although ITS had lower discriminatory power in Coffea, it efficiently discriminated C. liberica. The matK region was able to discriminate the three Coffea species, indicating
that this DNA barcode is efficient for authentication of commercially cultivated coffee at the species level.
Acknowledgements
The authors would like to thank the
University of Santo Tomas - RCNAS and Cavite State University for providing the laboratory
facilities. The first author is grateful to DOST-PCIEERRD and NMNH, Paris, France for
the sponsorship to training; CHED-FDP and DOST-PCAARRD for the financial grant.
Author Contributions
AP conducted the experiment and wrote the manuscript. MB and GJA edited
the manuscript.
References
Amin S, S
Ghosh, B Biswas, M
Arifuzzaman, AK Azad, Z Siddiki (2020). Molecular identification of four medicinal plants using
DNA barcoding approach from Chittagong, Bangladesh. J Adv Biotechnol Exp Ther 3:268–272
Bridson DM (1988). Coffea, pp:706–709.
Flora of Tropical East Africa, Rubiaceae.
Balkema, Rotterdam, The Netherlands
CBOL
Plant Working Group (2009). A DNA barcode for land
plants. Proc Natl Acad Sci USA 6:12974–12797
Chen Q, X Wu, D
Zhang (2020). Comparison of the abilities of universal, super, and
specific DNA barcodes to discriminate among the original species of Fritillariae cirrhosae bulbus and its
adulterants. PLoS One 15; Article e0229181
China Plant BOL
Group (2011). Comparative analysis of a large dataset indicates that
internal transcribed spacer (ITS)
should be incorporated into the core barcode for seed plants. Proc Natl Acad Sci 108:19641–19646
Davis AP, H Chadburn, J Moat, R
O’Sullivan, S Hargreaves, EN Lughadha (2019). High extinction risk for wild coffee species and
implications for coffee sector sustainability. Sci
Adv 5; Article eaav3473
Hebert PD, A Cywinska, S Ball, JRD Waard (2003). Biological identifications
through DNA barcodes. Proc Roy Soc Lond Ser B Biol Sci 270:313–321
Huang Y, X Chen, J Chen, Z Li (2019). DNA barcoding and phylogenetic
relationships in Omphalogramma (Primulaceae) from the Hengduan Mountain
region of China. Phytotaxa 402:97–106
Kimura M (1980). A simple method for estimating evolutionary rates of
base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16:111–120
Kumar S, G Stecher, K Tamura (2016). MEGA 7: Molecular evolutionary genetics
analysis version 7.0 for bigger datasets. BMC Ecol 33:1870–1874
Lecolier A, P Besse, A Charrier, TN Tchakaloff,
M Noirot (2009). Unraveling the origin of Coffea
arabica ‘Buorbon pointy’ from La Reunion: A historical and scientific
perspective. Euphytica 168:1–11
Li M, K Au, H Lam, L Cheng, R Jiang, P But, P
Shaw (2012). Identification of Baiying (Herba Solani Lyrati) commodity and its
toxic substitute Xungufeng (Herba Aristolochiae Mollissimae) using DNA
barcoding and chemical profiling techniques. Food Chem 135:1653–1658
Panaligan AC, MD Baltazar, GJD Alejandro
(2020). Genetic
polymorphism of registered and popularly cultivated coffee (Coffea spp.) in the Philippines using
inter-simple sequence repeats markers. Biodiversitas 21:4228–4233
White TJ, T Bruns, S Lee, J Taylor (1990). Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics.
PCR Protocols: A Guide to Methods and Applications,
pp:315–322.
Academic Press, Inc., New York, USA